DNA Decoding:
ATTCTACCCATGCTAAGACGCAAGCACCTGTATATTAGCTAACGTCTGAATCGACT
Wednesday, October 26, 2016
Thursday, October 20, 2016
Week 1: Historial Influences on Darwin: Lamarckism
Through time, there have been many scientists and great-thinkers who contributed to Darwin's idea and concept of evolution and his theory of Natural selection. However, John Baptiste Lamarck has had the most influence on Darwin due to his ideas that "organisms acquired features as they needed them" (amazingdiscoveries.org). Born on August 1, 1744, the French naturalist thought that in order for a giraffe to eat leaves from a tall tree, they would have to grow their necks or require to have longer necks to strive in the environment. In a sense, Lamarck proposed that "adaptations were acquired because organisms needed them," whereas Darwin constructed upon that concept and proposed that "the adaptations developed by chance through mutations and selection takes place by natural selection" (amazingdiscoveries.org). His main scientific achievement was that he proposed a relationship between the species and environment, in which if the environment is altered, the animal's behavior and "activity patterns" would be modified to accommodate the new environment and new conditions (Jurmain 30). According to Lamarck, due to this some parts of the body would be unused and some used, modifying them as well, in which the ones that were not used would disappear as time passes. On the other hand, the parts being put to use would be modified to be kept in use. The main idea that contributes to natural selection is that "a trait acquired by an animal during its lifetime can be passed on to the offspring" (Jurmain 30). Although it is true today that genetic information in the sperm and eggs can be inherited genetically, Lamarck's idea of traits being passed onto the offspring was a good hypothesis for this fact. Lastly, a very interesting contribution of Lamarck's was that he coined the term of "biology" that refers to the study of living organisms and central idea of species change.
There are two points that has heavy influence from Lamarck's ideas which are "Who gets better access to these limited resources?" and that "If the environment changes, the traits that are helpful or adaptive to that environment will be different." The first one explains that the organism that is better fit for the environment has a better chance to adapt to their environment with greater reproductive success. Lamarck contributed the idea that animals or organisms with certain traits can strive in a sense. His basic idea that these acquired characteristics were driven by the inner need, so what Lamarck tried to explain with the giraffes was that the one with the longer neck would be more successfully and this was due to the inner need. Thus, the ones with the longer necks have the acquired traits that Lamarck said with a changing environment would use and not use body parts, causing those traits to be inherited in offspring. However, the most influence of Lamarck's is on the other point because the other point explained that those with new adaptive traits will have greater reproductive success and those traits will spread, causing change in the population and environment. Lamarck's idea was that if the environment were to change then the animal's activity would change to adapt to that environment, in which those traits were inherited, influencing Darwin to manifest the idea that organisms suitable for an environment survive to reproduce and pass on their acquired traits and thus will spread on the change until the environment changes and another trait is favored. Therefore, Lamarck influence the idea that the traits driven from inner need that enabled the animals to survive was then passed on to the offspring the Darwin said would inherit the favorable trait and survive as well until the environment changes and according to Lamarck they modify themselves to suit the environment, while Darwin says the one with the new favorable trait strives in the new environment.
Furthermore, Lamarck's ideas were such a great influence to Darwin's interest in evolution and his ideas of natural selection that his theory could not have developed without it. The idea that the organisms with the desirable traits survive in the environment could not have been developed without the input of Lamarck's giraffe studies and theory that "a trait acquired by an animal during its lifetime can be passed on to the offspring" (Jurmain 30). Essentially, Lamarck had an idea that organisms had to acquire certain traits to prosper in an environment, while Darwin took that idea and expanded on it saying that those with the desirable acquired traits suited for the environment will strive to reproduce more offspring with those traits, which means that natural selection favors those that have the acquired trait suitable for the environment. Lastly, Charles Darwin himself also acknowleged Lamarck as being a massive influence for him as he wrote in 1861 "Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801. . . he first did the eminent service of arousing attention to the probability of all changes in the organic, as well as in the inorganic world, being the result of law, and not of miraculous interposition" (umcp.berkley.edu).
In the time that Darwin lived, science was seen as a threat to religion in a some way. As a member of established order he knew that many of his peers would be concerned with threats to the "status quo". Since he lived in a very religious society he was trouble with his wife who "saw his ideas as running counter to her strong religious convictions" (Jurmain 37). The church did not really like anything that went against the belief of God and religion in its entirety, so Darwin's evolution theory was seen as a threat. He continuously waited until Alfred Russel Wallace published an article that suggested that current species descended from other species, and after he was urged by Lyell and others to publish. After Wallace sent another paper to Darwin, he finally took action to publish his work, so that Wallace does not get all the credit. Due to people's attitude towards science with disbelief and the church's opposition to any other belief other than God, Darwin did not publish his theory until Wallace and other's urged him to.
Works Cited (Sources)
There are two points that has heavy influence from Lamarck's ideas which are "Who gets better access to these limited resources?" and that "If the environment changes, the traits that are helpful or adaptive to that environment will be different." The first one explains that the organism that is better fit for the environment has a better chance to adapt to their environment with greater reproductive success. Lamarck contributed the idea that animals or organisms with certain traits can strive in a sense. His basic idea that these acquired characteristics were driven by the inner need, so what Lamarck tried to explain with the giraffes was that the one with the longer neck would be more successfully and this was due to the inner need. Thus, the ones with the longer necks have the acquired traits that Lamarck said with a changing environment would use and not use body parts, causing those traits to be inherited in offspring. However, the most influence of Lamarck's is on the other point because the other point explained that those with new adaptive traits will have greater reproductive success and those traits will spread, causing change in the population and environment. Lamarck's idea was that if the environment were to change then the animal's activity would change to adapt to that environment, in which those traits were inherited, influencing Darwin to manifest the idea that organisms suitable for an environment survive to reproduce and pass on their acquired traits and thus will spread on the change until the environment changes and another trait is favored. Therefore, Lamarck influence the idea that the traits driven from inner need that enabled the animals to survive was then passed on to the offspring the Darwin said would inherit the favorable trait and survive as well until the environment changes and according to Lamarck they modify themselves to suit the environment, while Darwin says the one with the new favorable trait strives in the new environment.
Furthermore, Lamarck's ideas were such a great influence to Darwin's interest in evolution and his ideas of natural selection that his theory could not have developed without it. The idea that the organisms with the desirable traits survive in the environment could not have been developed without the input of Lamarck's giraffe studies and theory that "a trait acquired by an animal during its lifetime can be passed on to the offspring" (Jurmain 30). Essentially, Lamarck had an idea that organisms had to acquire certain traits to prosper in an environment, while Darwin took that idea and expanded on it saying that those with the desirable acquired traits suited for the environment will strive to reproduce more offspring with those traits, which means that natural selection favors those that have the acquired trait suitable for the environment. Lastly, Charles Darwin himself also acknowleged Lamarck as being a massive influence for him as he wrote in 1861 "Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801. . . he first did the eminent service of arousing attention to the probability of all changes in the organic, as well as in the inorganic world, being the result of law, and not of miraculous interposition" (umcp.berkley.edu).
In the time that Darwin lived, science was seen as a threat to religion in a some way. As a member of established order he knew that many of his peers would be concerned with threats to the "status quo". Since he lived in a very religious society he was trouble with his wife who "saw his ideas as running counter to her strong religious convictions" (Jurmain 37). The church did not really like anything that went against the belief of God and religion in its entirety, so Darwin's evolution theory was seen as a threat. He continuously waited until Alfred Russel Wallace published an article that suggested that current species descended from other species, and after he was urged by Lyell and others to publish. After Wallace sent another paper to Darwin, he finally took action to publish his work, so that Wallace does not get all the credit. Due to people's attitude towards science with disbelief and the church's opposition to any other belief other than God, Darwin did not publish his theory until Wallace and other's urged him to.
Works Cited (Sources)
"Jean-Baptiste Lamarck (1744-1829)." Jean-Baptiste Lamarck (1744-1829). N.p., n.d. Web. 19 Oct. 2016. <http://www.ucmp.berkeley.edu/history/lamarck.html>.
Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. Introduction to Physical Anthropology. N.p.: Wadsworth, Cengage Learning, 2014, 2012. Print.
"Lamarck Proposes Natural Selection." Amazing Discoveries. N.p., 15 Feb. 2009. Web. 19 Oct. 2016. <http://amazingdiscoveries.org/C-deception-Lamarck_natural_selection>.
Sunday, October 16, 2016
10/16/16- Two Things To Take To A Stranded Island:
If I was stranded on a desert island I would first take my phone with a portable charger so I can try to communicate as effectively as possible and to record my day to day basis of activities and my well-being. Also, having a phone would also help me keep up with the date and time, so I am not completely clueless in the island. While having those accessibilities with my phone, I could also look at the pictures of my family to bring me happiness and keep me positive while I am stranded. The second thing I would take with me is a first aid kit with medicine in order for me to stay healthy and prevent myself from getting any dangerous diseases. Also, a first aid kit would be helpful in trying to keep me to survive because by staying healthy I could obtain other resources from my environment.
Subscribe to:
Posts (Atom)