Week 8: Human Variation & Race-Cold

              Humans and other animals have migrated to many parts of the world, including colder climates. I chose the environmental stressor of the cold, in which humans and animals have adapted to internally regulate and survive these cold temperatures. First, humans in these climates face the dangers of developing hypothermia, which is when the body temperature drops to abnormally low levels posing danger to one's life and survival. The normal body temperature is 98.6 degrees Fahrenheit, while when hypothermia begins the body temperature drops to 94 degrees Fahrenheit and after 85 degrees Fahrenheit (below it) the hypothalamus fails to regulate the body's temperature and the body cools down quicker posing much danger. These low body temperatures may cause death and can only be revived if the body's temperature has dropped to the lowest of 57 degrees Fahrenheit. However, a bit more dangerous disruption to the homeostasis would be frostbite, in which the environmental temperature is below freezing point and the normal vasoconstriction is more prolonged causing the body to reach the point of frostbite. Thus, with these two disruptions of homeostasis in mind, surviving the cold would be difficult if we did not adapt.

        In order to survive and conquer through the colder temperature and climates, humans have adapted through short-term, facultative, developmental, and cultural adaptations. A short-term adaptation that allows humans to respond quickly to the cold to maintain homeostasis is shivering. Shivering may cause a short-term warming effect and its increased muscle activity produces some heat. 

             As a facultative adaptation to cold temperatures, which are genetic traits, an adaptation could be increased basal metabolic rate. When people traditionally consumed large quantities of fat-filled and high calorie foods they increased their basal metabolic rate that results in the production of extra body heat. As seen in the graph/image below the more weight, the more higher basal temperature, which produces more heat keeping the body warmer to colder temperatures. 

         Another adaptation called an developmental adaptation, an actual change in DNA of a population, in which could be for cold temperatures having a "stocky body with short appendages" which can be more effective with heat production because less surface area increases heat production. This according to Allen's rule would be an advantage to people in such extremely cold environments. 

       The last adaptation is called an cultural adaptations, which is the use of culture to adapt to environmental stress. In response to colder temperatures, as an cultural adaptation would be wearing heavy clothing as the Inuit (Eskimo) of the northern regions of the western hemisphere and the Indians of Tierra del Fuego at the southern end did to maintain body heat in the extreme cold temperatures.  Wearing thicker and heavy clothing shield the body from most of the cold temperatures of the environment and can promote heat production in the body. 

        By studying human variation from the perspective across environmental clines, we can learn how humans have adapted and evolved in order to survive different environments and geographical locations. Also, with this studying and knowledge, we can learn how our bodies have evolved to react to these stressors so that when we are pressured by the environmental stressor we will know how our body may react and how we need to ensure our body is trying to regulate itself or proceeding with homeostasis. For instance, if in Southern California a dangerous snow/ice storm struck out of nowhere, in which our bodies are used to heat and warmer temperatures, we may use this knowledge about these adaptations to see if our body is trying to regulate our body temperature. Also, if we see our body is being ineffective in regulating our body temperature, with the acquired knowledge from the studies, we may eat a fatty food to increase basal metabolic rate or wear heavy clothing as the Inuit in order to attempt to regulate our body temperature and ensure our survival from the extreme cold temperatures. Lastly, we can learn to differentiate when we our in danger of frostbite and how we can prevent this with our adaptations, in which can apply to any of the environmental stressors. 

     Race cannot be used to understand the variation of any adaptations because race is a socially constructed idea more than a factor we could use to study variation. We categorize and create the meaning of race, whereas the study of environmental influences on adaptations can give us more insight to human variation than race can. By studying these environmental influences we are able to see how different people in different environments react displaying variation rather than race, in which there can be many people in one area of different races that do not exhibit variation due to the environment. For instance, as mentioned before, those living in harsh subarctic regions, such as the Inuit, wore heavy clothing and slept in a huddle with each other in order to harness warmth and heat production. The Indians of Tierra del Fuego also exhibited these adaptations, showing how the environment shows the variation and clearly not the race of the people because race is a socially-crafted idea. 

Works Cited: 

"Human Biological Adaptability: Adapting to Climate Extremes." Anthro.Palomar. N.p., n.d. 

      Web. 05 Dec. 2016. <http://anthro.palomar.edu/adapt/adapt_2.htm>.

Week 7: Language

          For part 1 at first, I thought that being asked to engage in a conversation for 15 minutes where I could not use any method of symbols language would not be very difficult because I thought I could convey meaning with my gestures. However, not being able to speak or use any version of symbolic language created a barrier, in which the communication between me and my friend was not successful. To test this task, I asked my 2 of my friends to participate with me and informed them the circumstances, in which I was not able to use symbolic language. We together thought 15 minutes of trying to communicate with me not being able to speak or write would be a breeze because we thought we could treat it like a normal conversation. The conversation began talking about Black Friday shopping plans and the deals that were going to be coming up at the shops, which ignited the conversation for my friends, but as for me I was trying to show my opinions about the stores' deals through emotions and by using my body, and we sort of progressed through the conversation. However, the more my friends started talking more about what they want to shop for and what is the plan we are going to execute for shopping, I had a very limited say because I could not necessarily communicate what I felt we should do. Seeing my difficulty, my friends tried asking more questions that were simpler to respond with a gesture than a game of charades put on by my attempt to communicate. During the conversation, my friends tried to include me as much as they could, but since I was not contributing much to the conversation, it felt as if they were becoming tired of guessing what I wanted to say. However, since we were trying to actual attempt to make decisions for our shopping on Black Friday, my friends started asking very basic questions in order to try to get my opinion, so we could decide our plan and actually drive the conversation somewhere. They started listed stores, in which I simply smiled or nodded if I liked or made a face with discontent for the stores I did not want to go to. Overall, we did end up creating some sort of conversation with the altered basic questioning of my friends, but not being able to speak or communicate with writing made it harder for me to express to my friends exactly my desires for our plans for shopping.
      Due to the lack of being able to speak or use symbolic language, my friends had total domination of the conversation, and they were the ones changing topics from what we want to buy to where we would like to go and what we want to do afterwords. It was very difficult for me to ask question, due to fact that I could not speak, so my friends asked most of the questions and mostly they both responded while I was just showing emotions or gestures as my responses. At times, I did feel excluded from the conversation because when talking about one subject, my friends would just talk on and on about what each other was saying. I was not contributing much to the conversation, so I feel that my friends felt that and at times I felt they were talking to each other. In the conversation we had, I felt that my friends had more power because they were the ones initiating and guiding the conversation. Lastly, I felt like I had no power within the conversation because I was not able to effectively guide it with questions and more complex opinions, which instead I was only able to make basic gestures to get my ideas or opinions across; I truly wanted to reply and contribute, but I felt there was a difficult barrier of communication without language.
     In addition, I feel that my friends as the culture that uses spoken language has the advantage of communicating their complex ideas within their population and society because they could actually express their opinions in a more understandable and effective manner. I think in a sense, the speaking culture may feel more at power and judge in a way the other culture who does not use symbolic language. In other words, the speaking culture may feel more superior because they have the advantage of expressing more complexity in concepts, whereas this other culture may be more simple in expressing necessary ideas. The only modern situation I can recall is the Deaf culture, who is not able to listen in order to communicate effectively, and in our society some of those people are not treated fairly to those who have those abilities. Sometimes we may treat these people differently, not regard their ideas, but we forget that just because we have an advantage does not make us superior, which is what some cultures have done, but in the we are all people with the potential to succeed.
    During part 2, I had a totally different outlook before I even had started; I thought it would be very difficult to speak without any emotional expressions or body language because I am very prone to talk with my hands or change my tone for certain expressions to express my thoughts. In this conversation, I started the conversation with talking about the Christmas movies I was planning to watch, and what recipes we can bake during the upcoming winter break. My friends happily responded to my questions about the movies upcoming and what they were planning on watching, but it was the hardest thing not get excited and not to show any facial movements. I really wanted to smile or exclaim how much I loved this one movie or express disgust when talking about this horrible cake recipe, but for me I think that limited my true opinion with what I say to complete my idea. This assignment was very difficult because I really like to smile or use my head to nod or show approval when talking about different ideas, but I was not able to do any of that to actually show how I feel about what I say. My friends did not truly understand what I truly meant with what I saying, and they could not tell if I was feeling very excited or truly disgusted with some of the ideas I was trying to express. In response, they tried to understand as much as they could with my words and relied less on my face because I could not express my emotions. They tried to create more subject that evoked less emotion and they tried to truly study my words to understand how I truly feel. Lastly, they had much difficulty as well in understanding my emotions because it was like I was monotone, and they were becoming disinterested because  they felt as if there was no life in me as I was not expression emotions or intonations.
      With the results from this experiment, it is safe to say that non-speech language aids conjointly with spoken language to create our ability to communicate effectively. I think this is very important the use of body language and changing our tone and changing our facial expression show how strong or candid we feel about what we are saying. For instance, if one were to say "Wow, that is so good." without any emotion or intonations, then we would not believe them and we would not feel the same excitement as if someone were to exclaim with a smile "Wow that is so good!" showing how tone and facial expressions can aid to effective communication. Humans receive the actual expression of how the person actually feels and an insight into their emotions when they "read" a person's body language. With body language, they can gain insight into excitement, anger, disgust, or plain candidness. Thus, it is very important to use non-speech language techniques in order to create a frank and effective communication within individuals.
     Being able to read body language is very important and adaptively beneficial because it may alert one of someone's feelings and may contribute to stress in order for the means of arrival. For instance, if one were to just inform the group about a danger with a monotone voice and no emotions, then the group cannot react and may not even be able to realize the urgency of the situation, but with a worried/frightened tone and trembling hands can stress the urgency to act fast to avoid the danger and survive. Reading body language can also give insight to the motives and more emotions of an individual, so if one is able to detect that the body language one is using, then they can deem if that person is harmful to them or if he or she is being frank. By understanding the body language, one can escape dangerous and stressful situations leading them to  survive and reproduce successfully.
     There are some people in this world that do have difficulty reading body language as it may be an ability gained from experience. However, I feel that from a young age we depend on body language to communicate our concerns because we see babies do that all the time. In our society, practically everyone reads body language to understand what each other is saying. However, children with autism have a difficulty with reading body language because they have a hard time making eye contact with the person they are speaking with. I think a situation where it might be beneficial not to read someone's body language would be when they are saying something, but feeling otherwise or known as telling a lie. For instance, if someone is telling you about a boy you like, but you get so hung up with the their tone and facial expressions that you do think they hate that boy, in which is a facade, so listening to their words would have been much better. Although there may be cases as this, people mostly depend on both speaking and body language for effective means of communication.

Week 5: Piltdown Hoax

     In 1912, in Piltdown Village of England, an amateur anthropologist, Charles Dawson, claimed to have found a piece of an ancient human skull. Dawson invited geologist, Arthur Smith Woodward to join him and also invited a French paleontologist, Father Pierre, to join him at Piltdown. At the grave pit, animal fossils were found that date back to around a million years old. He dug up a jaw bone and a skull, which looked as if it was an ape, and looked as if they had found the common ancestor or lineage between the humans and apes.
      This scientific find was significant because England had finally found fossils that could be the oldest human-like fossils of all. It was also significant because the fossils back up anatomist Arthur Keith's theory of human evolution that humans developed big brains before humans walked up right. Scientists now know that the opposite is true; up right walking is developed before the big brain. They had found more fossils in Piltdown, the original trio, so the controversies behind the find were not much voiced. It established nature at the time and it possibly proved Charles Darwin's evolutionary theory, and with the recognition of the first Englishman fossil, it was a significant scientific discovery at the time. After Charles Dawson's death in 1916, no more fossils were set to be found in Piltdown, but were found elsewhere in other parts of the world. Those fossils found in Asia, Africa, etc. after his death were dated hundred thousands of years after Piltdown man, which on the contrary deviated from looking human-like. It was kept on close guard, so it was not given many of the opportunities for a large study to find out the truth of the fossils and the linkages, until it was found to be a hoax through updated scientific processes later mentioned.
      Scientists and humans in general all have faults when it comes to curiosity and the desire to reach success. People have the tendency to do whatever it takes to fulfill this desire of success and their own personal satisfaction. The faults that negatively impacted this scientific process was jealousy and urge for fame and success, and competition. As humans, it is our motive to compete and outcompete others for resources and our needs, so it is possible that the drive to receive attention and outcompete others for success may have urged anthropologist Dawson to create this hoax in order to get some recognition for an "apparent" discovery, which in turn then was found out to be an hoax. People usually are jealous of others in society even to this day, so it is obvious scientist will display a sense of jealousy as well. Because the rest of the world was advancing in discoveries, the British anthropologist was jealous of this fact and since England did not have any major fossil discoveries, he felt enraged to create one is a possibility. In present society, these faults of jealousy, competition, and self-success desire does not seem inevitable because we see it in every aspect of society, whether it would be education or in families, all these faults affect us as humans and could have negatively impacted this scientific process turning it into a competitive game instead of an actual true advancement to the scientific world.
     Then a major turn point after World War II, gave scientists the technology to use fluorine to accurately date fossils. In 1949, scientists conducted a fluorine test on the Piltdown fossils, showing a shocking discovery that the fossils were pretty young dating up to one hundred thousand years old. Alas, in 1953, scientists launched the full scale analysis with better dating methods. The artifacts had been stained and were cut before of the fossil using  a steel knife. Kenneth Oakley applied a chemical test to authenticate to fossils, which also revealed the Piltdown man was much younger in age. When the scientists looked at Piltdown man's teeth using a microscope, they found that the teeth had been filed down, there had been scratch marks that had been scraped down for a particular desired shape. The jaw bone actually dated up to one hundred years, which was found to be a fossil of a female orangutan. Pieces were broken off from the jaw bone, which could have shown that jaw bone did not belong to the skull, so they had removed those pieces to make it much. The front canine tooth had been filed down and rubbed down to make it smaller, and the front part of the jaw is been broken off, to eliminate the telling signs that it actually is ape and not a human clone. Charles Dawson became a prime suspect and is now known to have forged thousands fossils and findings. It is believed that Martin Hinton may be involved as well because they had found stained artifacts in his trunk as well. However, the mystery of the suspect of the Piltdown man still remains today.
    In my opinion, it is not really possible to remove the "human" factor from science to reduce such errors because as humans we make mistakes, so as much as we would want to remove possibilities of error, we cannot because that is in our nature. That is why we create certain methods to try to eliminate the error as much as we can and with a low percentage of error, we are able to claim a discovery or answer to our hypothesis. It is not possible in my opinion, to discover an idea with no sources of error because as we experiment we account for sources of error and we repeat experiments to lower that percent to be as accurate as we can get. Having personal opinions and ideas on a theory or concept drive the science to discovery as well, so as much as we try to eliminate that, we cannot because that is how we derive these major concepts that are claimed in science today. I would not want to remove the human factor from science because I think each person's opinions may drive the experiment and theory to another level and can increase the possibilities from an infinite amount of discoveries. Lastly, human factor is needed in order to create hypotheses and test ideas that have been generated by human thought in order for us to derive theories in the scientific field.
    With regards to this historical hoax event, I learned the valuable lesson that assuming evidence from unverified sources can lead to misleading information that can impact other discoveries and other concepts later on. In general, as a college student and high school student, this lesson can be applied to using research from unverified sites and articles that may mislead us with information on a particular issue and negatively affect our understanding on an particular issue. In regards to science and experimentation, due to this hoax event, we should not assume certain discoveries from unverified sources as an amateur anthropologist in this case, instead we should test to make sure those sources are verified and then test the evidence found so we could verify the discovery as a whole.

Analogy and Homology Week 3

 Homology:

 

 

   Humans and whales are primarily homologs and are more related than it may seem. 

     Humans or homo sapiens, being classified in genus homo and species sapiens, are reproductive mammals that does not necessarily have a specimen, but we recognize human beings as homo sapiens. Additionally, humans are nested in the primate category within also the great ape family. On the other hand, whales are marine aquatic mammals who nurse their young. Also, whales have a thick layer of fat on them called a blubber that insulates them and provides heat and warmth from the cold waters and temperatures. Most whales have teeth, such as the beluga or sperm whales, whereas some have special structures in their mouth called baleen to strain food, such as blue, gray, and bowhead whales. All in all, both these mammals may sound different but they have evolved with some of the same structures. 

     The flipper of a whale and an arm of human are closely related and have the same bones almost. However, if not evident in the photos below, both humans and whales have bones that are structurally the same, but they are sized differently. For instance, the humerus of a human is probably three times longer than a whale's humerus. Also, the shape of the bones of the whale have a slight tilt to match the shape of the flipper, while the human's bones are more longer and not as bent. Although they both have very similar bones, whales use there flippers and the limbs themselves for swimming and guiding themselves in the water. On the contrary, humans use their arms and their limbs in their arms to bend it and basically do anything we can possibly do, whether it would be writing notes, washing dishes, controlling the steering wheel while driving and etc. Due to evolution and habitual differences, the homologous trait of the similar limb in the arm exhibit different functions and have evolved to different sizes and alternate shapes in order to be compatible for that function; whales for swimming with their flippers and humans for using their arm on a daily basis. Lastly, in order for the whale to use its flipper to navigate through the waters and flap it, the shape of the limbs has evolved to provide that functions, whereas for humans the shape of the limbs has evolved to fit the function of being able to bend the arm in many ways to do daily tasks needed for humans and their survival. 

          Generally speaking, the common ancestor of both humans and whales was most likely a four-legged insect-eater that lived hundred of thousands years after the dinosaurs were extinct. As you may imagine, this creature was small and scurrying, but by having these structures as they are studying now, this insect-eater is the most recent common ancestor for these two species. 

 

 Analogy: 

Who would have thought that us humans can have similar qualities with an octopus? 

  

        To begin with, as described before, humans are called homo sapiens and they are mammals and primates closely related to the primate and apes family. Humans are one of more than 200 species that belong to the order of Primates. The most common ancestor for homo sapiens is the neanderthals who are extinct. On the other hand, octopi are cephalopod mollusks that have two eyes, four pairs of arms, and are bilaterally symmetric. Most octopi live along the ocean floor in all of the world's oceans, especially in warmer tropical waters. If they are threatened, they will disperse an inky black fluid that darkens the water as a defense mechanism. They can also communicate with each other by changing colors. Now, how they have similar eyes if they are so different? 

        The analogous trait that humans share with octopi is the similarity in eye structures, but having no evolution with the similar structures in the eye. They both have a lens, retina, eyelid, cornea, pupil, iris, muscles, optic nerve, and optic ganglion. However, the only differences would be focusing and resolution due to the absence of the blind spot in the octopus, which humans have. On the contrary, both fill the function of providing great eyesight for both octopi and humans. Also, they both contain the Pax6 gene that directs the formation of the eye, and in order to create complex structures to fill different environments, the number of directions from the single gene evolved. Because they lived in related environment in a way, filled similar equal ecological tasks, through natural selection that type of structure was favored in different ancestors, thus displaying the evolution and similarities in both these eyes of both species. 

      Since the octopi and humans are very far from each other on the phylogenic tree, there has not yet been a common ancestor found that these two could share. The only hypothetical assumption of the last common ancestor these two may share is the urbilaterian, in which has bilateral symmetry, but also possesses the Pax6 gene that directs the formation of the eye, which may be where these two species evolved from. However, since they are very far from each other, this is an assumption, but it is the most probable ancestor with the similar genes that later evolved to create the complex eyes of humans, octopi, etc. 

Works Cited:

By Comparing the Traits of Species That Are Both Closely and Distantly Related to Each Other, We Can Begin to Understand Their Evolutionary History. "Evidence of Evolution: Homology Sometimes a Discussion of Evolution Needs to Consider How Evolution Does NOT Happen." BIL 160. N.p., n.d. Web. 03 Nov. 2016. <http://www.bio.miami.edu/dana/160/160S13_5.html>. 

Conversation_, By Malcolm Campbell_ The. "How Humans And Squid Evolved To Have The Same Eyes." Popular Science. N.p., n.d. Web. 04 Nov. 2016. <http://www.popsci.com/article/science/how-humans-and-squid-evolved-have-same-eyes>. 

"Difference between Homologous and Analogous Structures." Difference Between. N.p., 08 Oct. 2016. Web. 03 Nov. 2016. <http://www.differencebtw.com/difference-between-homologous-and-analogous-structures/>. 

"Octopus." Nationalgeographic.com. N.p., 01 Mar. 2014. Web. 04 Nov. 2016. <http://kids.nationalgeographic.com/animals/octopus/#octopus.jpg>. 

"The Search for the Urbilaterian Ancestor." Developmental Biology 10e Online:. N.p., n.d. Web. 03 Nov. 2016. <http://10e.devbio.com/article.php?id=305>. 

Smithsonian's National Museum of Natural History. "Homo Sapiens | The Smithsonian Institution's Human Origins Program." Homo Sapiens | The Smithsonian Institution's Human Origins Program. N.p., 01 Mar. 2010. Web. 03 Nov. 2016. <http://humanorigins.si.edu/evidence/human-fossils/species/homo-sapiens>. 

"Whale." WorldWildlife.org. World Wildlife Fund, n.d. Web. 04 Nov. 2016. <http://www.worldwildlife.org/species/whale>. 

"What Are Homologous Structures?" About.com Education. N.p., 02 Jan. 2016. Web. 04 Nov. 2016. <http://evolution.about.com/od/evidence/a/Homologous-Structures.htm>. 

Protein Synthesis: DNA Decoding

DNA Decoding:

ATTCTACCCATGCTAAGACGCAAGCACCTGTATATTAGCTAACGTCTGAATCGACT

Week 1: Historial Influences on Darwin: Lamarckism

        Through time, there have been many scientists and great-thinkers who contributed to Darwin's idea and concept of evolution and his theory of Natural selection. However, John Baptiste Lamarck has had the most influence on Darwin due to his ideas that "organisms acquired features as they needed them" (amazingdiscoveries.org). Born on August 1, 1744, the French naturalist thought that in order for a giraffe to eat leaves from a tall tree, they would have to grow their necks or require to have longer necks to strive in the environment.  In a sense, Lamarck proposed that "adaptations were acquired because organisms needed them," whereas Darwin constructed upon that concept and proposed that "the adaptations developed by chance through mutations and selection takes place by natural selection" (amazingdiscoveries.org). His main scientific achievement was that he proposed a relationship between the species and environment, in which if the environment is altered, the animal's behavior and "activity patterns" would be modified to accommodate the new environment and new conditions (Jurmain 30).  According to Lamarck, due to this some parts of the body would be unused and some used, modifying them as well, in which the ones that were not used would disappear as time passes. On the other hand, the parts being put to use would be modified to be kept in use. The main idea that contributes to natural selection is that "a trait acquired by an animal during its lifetime can be passed on to the offspring" (Jurmain 30). Although it is true today that genetic information in the sperm and eggs can be inherited genetically, Lamarck's idea of traits being passed onto the offspring was a good hypothesis for this fact. Lastly, a very interesting contribution of Lamarck's was that he coined the term of "biology" that refers to the study of living organisms and central idea of species change.

         There are two points that has heavy influence from Lamarck's ideas which are "Who gets better access to these limited resources?" and that "If the environment changes, the traits that are helpful or adaptive to that environment will be different." The first one explains that the organism that is better fit for the environment has a better chance to adapt to their environment with greater reproductive success. Lamarck contributed the idea that animals or organisms with certain traits can strive in a sense. His basic idea that these acquired characteristics were driven by the inner need, so what Lamarck tried to explain with the giraffes was that the one with the longer neck would be more successfully and this was due to the inner need. Thus, the ones with the longer necks have the acquired traits that Lamarck said with a changing environment would use and not use body parts, causing those traits to be inherited in offspring. However, the most influence of Lamarck's is on the other point because the other point explained that those with new adaptive traits will have greater reproductive success and those traits will spread, causing change in the population and environment. Lamarck's idea was that if the environment were to change then the animal's activity would change to adapt to that environment, in which those traits were inherited, influencing Darwin to manifest the idea that organisms suitable for an environment survive to reproduce and pass on their acquired traits and thus will spread on the change until the environment changes and another trait is favored. Therefore, Lamarck influence the idea that the traits driven from inner need that enabled the animals to survive was then passed on to the offspring the Darwin said would inherit the favorable trait and survive as well until the environment changes and according to Lamarck they modify themselves to suit the environment, while Darwin says the one with the new favorable trait strives in the new environment.

    Furthermore, Lamarck's ideas were such a great influence to Darwin's interest in evolution and his ideas of natural selection that his theory could not have developed without it. The idea that the organisms with the desirable traits survive in the environment could not have been developed without the input of Lamarck's giraffe studies and theory that "a trait acquired by an animal during its lifetime can be passed on to the offspring" (Jurmain 30). Essentially, Lamarck had an idea that organisms had to acquire certain traits to prosper in an environment, while Darwin took that idea and expanded on it saying that those with the desirable acquired traits suited for the environment will strive to reproduce more offspring with those traits, which means that natural selection favors those that have the acquired trait suitable for the environment. Lastly, Charles Darwin himself also acknowleged Lamarck as being a massive influence for him as he wrote in 1861 "Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801. . . he first did the eminent service of arousing attention to the probability of all changes in the organic, as well as in the inorganic world, being the result of law, and not of miraculous interposition"  (umcp.berkley.edu).

     In the time that Darwin lived, science was seen as a threat to religion in a some way. As a member of established order he knew that many of his peers would be concerned with threats to the "status quo". Since he lived in a very religious society he was trouble with his wife who "saw his ideas as running counter to her strong religious convictions" (Jurmain 37).  The church did not really like anything that went against the belief of God and religion in its entirety, so Darwin's evolution theory was seen as a threat. He continuously waited until Alfred Russel Wallace published an article that suggested that current species descended from other species, and after he was urged by Lyell and others to publish. After Wallace sent another paper to Darwin, he finally took action to publish his work, so that Wallace does not get all the credit. Due to people's attitude towards science with disbelief and the church's opposition to any other belief other than God, Darwin did not publish his theory until Wallace and other's urged him to.



Works Cited (Sources)

"Jean-Baptiste Lamarck (1744-1829)." Jean-Baptiste Lamarck (1744-1829). N.p., n.d. Web. 19 Oct. 2016. <http://www.ucmp.berkeley.edu/history/lamarck.html>. 

Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. Introduction to Physical Anthropology. N.p.: Wadsworth, Cengage Learning, 2014, 2012. Print. 

"Lamarck Proposes Natural Selection." Amazing Discoveries. N.p., 15 Feb. 2009. Web. 19 Oct. 2016. <http://amazingdiscoveries.org/C-deception-Lamarck_natural_selection>. 

10/16/16- Two Things To Take To A Stranded Island:

If I was stranded on a desert island I would first take my phone with a portable charger so I can try to communicate as effectively as possible and to record my day to day basis of activities and my well-being. Also, having a phone would also help me keep up with the date and time, so I am not completely clueless in the island. While having those accessibilities with my phone, I could also look at the pictures of my family to bring me happiness and keep me positive while I am stranded. The second thing I would take with me is a first aid kit with medicine in order for me to stay healthy and prevent myself from getting any dangerous diseases. Also, a first aid kit would be helpful in trying to keep me to survive because by staying healthy I could obtain other resources from my environment.